String plus. Mastering String Concatenation in Kotlin: Techniques and Best Practices

How do you concatenate strings in Kotlin. What are the most efficient methods for string concatenation in Kotlin. Which technique provides the best performance for joining strings in Kotlin. When should you use StringBuilder for string concatenation in Kotlin.

Understanding String Concatenation in Kotlin

String concatenation is a fundamental operation in programming, involving the joining of two or more strings to create a single, combined string. In Kotlin, developers have several options for performing this task, each with its own advantages and use cases. Let’s explore the most common and efficient methods for string concatenation in Kotlin.

String Templates: The Simplest Approach

One of the most straightforward and readable ways to concatenate strings in Kotlin is by using string templates. This method allows for easy interpolation of variables directly within a string.

How do string templates work in Kotlin?

String templates in Kotlin use the $ symbol to insert variable values into a string. For complex expressions, you can use ${} to enclose the expression. Here’s an example:

fun main() {
    val str1 = "hello"
    val str2 = "world"
    val result = "$str1 $str2"
    println(result) // Output: hello world
}

This approach is clean, concise, and highly readable, making it an excellent choice for simple concatenations.

The Plus (+) Operator: A Familiar Method

For those coming from other programming languages, using the + operator for string concatenation will feel familiar. Kotlin supports this method, translating it into a plus() function call behind the scenes.

Is the + operator efficient for string concatenation in Kotlin?

While the + operator is convenient, it’s not always the most efficient method, especially when concatenating multiple strings or in loops. For simple operations, it’s perfectly acceptable, but for more complex scenarios, other methods might be preferable. Here’s how it works:

fun main() {
    val str1 = "hello"
    val str2 = "world"
    val result = str1 + " " + str2
    println(result) // Output: hello world
}

StringBuilder: Optimizing Performance

For scenarios involving multiple concatenations or when building strings in loops, StringBuilder offers a more efficient solution. It allows for mutable string operations, reducing memory overhead.

When should you use StringBuilder in Kotlin?

Use StringBuilder when you’re performing multiple concatenations, especially in loops or when building large strings. It’s more efficient than repeatedly creating new String objects. Here’s an example:

fun main() {
    val sb = StringBuilder()
    sb.append("hello")
    sb.append(" ")
    sb.append("world")
    val result = sb.toString()
    println(result) // Output: hello world
}

Comparing Concatenation Methods: Performance and Readability

Each string concatenation method in Kotlin has its strengths and ideal use cases. Let’s compare them based on performance and readability:

• String Templates: High readability, good performance for simple concatenations
• + Operator: Familiar syntax, suitable for basic operations
• StringBuilder: Best performance for multiple concatenations, slightly more verbose

Choosing the right method depends on your specific needs, balancing between code clarity and performance requirements.

Best Practices for String Concatenation in Kotlin

To ensure your code is both efficient and maintainable, consider these best practices for string concatenation in Kotlin:

1. Use string templates for simple, readable concatenations
2. Opt for StringBuilder when dealing with multiple concatenations or loops
3. Avoid excessive use of the + operator in loops to prevent performance issues
4. Consider the readability of your code alongside performance concerns

Advanced String Manipulation Techniques in Kotlin

Beyond basic concatenation, Kotlin offers several advanced techniques for string manipulation that can enhance your coding efficiency and expressiveness.

How can you use multiline strings in Kotlin?

Kotlin supports multiline strings using triple quotes (“”””). This feature is particularly useful for formatting complex strings or including large blocks of text:

val multilineString = """
    This is a
    multiline string
    in Kotlin
""".trimIndent()
println(multilineString)

The trimIndent() function removes common indentation, making the output cleaner.

Can you perform string transformations efficiently in Kotlin?

Kotlin provides several built-in functions for string transformations, which can be more efficient and readable than manual concatenation in some cases:

• capitalize(): Capitalizes the first character of a string
• trimMargin(): Removes leading whitespace from multiline strings
• padStart() and padEnd(): Add padding to strings

These functions can often replace complex concatenation logic with more concise and expressive code.

String Concatenation in Real-World Kotlin Applications

Understanding how to apply string concatenation techniques in practical scenarios is crucial for Kotlin developers. Let’s explore some common use cases and how to approach them efficiently.

Building Dynamic SQL Queries

When constructing SQL queries dynamically, string concatenation is often necessary. However, it’s important to use safe methods to prevent SQL injection vulnerabilities:

fun buildQuery(tableName: String, condition: String): String {
    return StringBuilder()
        .append("SELECT * FROM ")
        .append(tableName)
        .append(" WHERE ")
        .append(condition)
        .toString()
}

Using StringBuilder in this case allows for efficient building of the query string while maintaining readability.

Generating HTML Content

For web applications, generating HTML content dynamically often involves string concatenation. Here’s an example using string templates:

fun generateHtmlList(items: List): String {
    return """
        

            ${items.joinToString("") { "
$it
" }}
        
    """.trimIndent()
}

This approach combines the readability of string templates with the power of Kotlin’s functional programming features.

Performance Optimization Tips for String Operations

While string concatenation is a common operation, it can become a performance bottleneck if not handled correctly. Here are some tips to optimize your string operations in Kotlin:

Avoid Concatenation in Loops

Instead of concatenating strings inside a loop using the + operator, use StringBuilder or collect the strings and join them afterwards:

val items = listOf("apple", "banana", "cherry")
val result = items.joinToString(", ") // More efficient than loop concatenation
println(result) // Output: apple, banana, cherry

Use String Interning for Repeated Strings

If you’re working with a large number of duplicate strings, consider using string interning to reduce memory usage:

val internedString = String("hello").intern()

This technique can be particularly useful in scenarios where you’re dealing with a large number of repeated string values.

Leveraging Kotlin’s Standard Library for String Operations

Kotlin’s standard library provides a rich set of functions for string manipulation that can often replace manual concatenation with more efficient and readable alternatives.

How can you use the ‘let’ function for nullable string concatenation?

The ‘let’ function can be particularly useful when dealing with nullable strings:

val nullableString: String? = "Hello"
val result = nullableString?.let { "$it World" } ?: "Default Value"
println(result) // Output: Hello World

This approach allows for safe concatenation with nullable strings while providing a default value if the string is null.

Utilizing the ‘repeat’ function for string repetition

Instead of using a loop to repeat a string multiple times, you can use the ‘repeat’ function:

val repeatedString = "Hello".repeat(3)
println(repeatedString) // Output: HelloHelloHello

This method is more concise and often more efficient than manual repetition through concatenation.

Common Pitfalls in String Concatenation and How to Avoid Them

While string concatenation in Kotlin is generally straightforward, there are some common mistakes that developers should be aware of to write more efficient and maintainable code.

Excessive Concatenation in Loops

One of the most common pitfalls is performing string concatenation inside loops using the + operator. This can lead to poor performance due to the creation of multiple intermediate String objects. Instead, use StringBuilder or collect the strings and join them after the loop:

// Inefficient
var result = ""
for (i in 1..1000) {
    result += i.toString() + ", "
}

// Efficient
val result = (1..1000).joinToString(", ")

Ignoring Null Safety in Concatenation

When concatenating strings that might be null, it’s important to handle null cases properly to avoid NullPointerExceptions:

val name: String? = null
val greeting = "Hello, " + (name ?: "Guest") // Safe concatenation
println(greeting) // Output: Hello, Guest

Using the Elvis operator (?:) or safe calls (?.) can help prevent null-related issues in string concatenation.

Future-Proofing Your String Concatenation Code

As Kotlin continues to evolve, it’s important to write code that can easily adapt to future changes and improvements in the language.

Embracing Functional Approaches

Kotlin’s functional programming features can often provide more elegant solutions to string manipulation problems. Consider using functions like map, fold, or reduce for complex string operations:

val words = listOf("Kotlin", "is", "awesome")
val sentence = words.fold("") { acc, word -> "$acc $word" }.trim()
println(sentence) // Output: Kotlin is awesome

This approach is not only more concise but also aligns well with Kotlin’s functional programming paradigms.

Staying Updated with Kotlin Updates

Keep an eye on Kotlin updates and new language features that might improve string handling. For example, Kotlin 1.4 introduced new functions for string manipulation that can make your code more efficient and readable.

By understanding these advanced concepts and best practices, you can write more efficient, readable, and maintainable code when working with strings in Kotlin. Remember to always consider the specific needs of your project when choosing a string concatenation method, and don’t hesitate to leverage the power of Kotlin’s standard library and functional programming features for complex string operations.

String Concatenation in Kotlin

String concatenation is joining two or more strings together. In this guide, we will see three ways to concatenate strings in Kotlin.

1. String templates

One of the simplest way of concatenating strings is by using String templates.

fun main(args: Array<String>) {

    val str1 = "hello"
    val str2 = "hi"
    val str3 = "bye"

    // string interpolation
    val str4 = "$str1 $str2 $str3"

    // displaying concatenated string
    println(str4)
}

Output:

hello hi bye

Note: We have space in between the strings because we have given the space while using string template in str4.

2. String concatenation using Plus (+) Arithmetic Operator

We have seen in the Kotlin Operators tutorial that + arithmetic operator is used for addition. The same operator can also be used for string concatenation as shown in the example below. The + operator is translated into a plus() function.

fun main(args: Array<String>) {

    val str1 = "hello"
    val str2 = "hi"
    val str3 = "bye"

    // joining using + operator
    // can also be written like this: 
    // val str4 = str1.plus(str2).plus(str3)
    val str4 = str1 + str2 + str3

    // displaying concatenated string
    println(str4)
}

Output:

hellohibye

3. Concatenation using StringBuilder

We can join strings using StringBuilder and then assign it to string by using a toString() function on the StringBuilder object.

fun main(args: Array<String>) {

    val str1 = "hello"
    val str2 = "hi"
    val str3 = "bye"

    // Obtaining StringBhuilder Object
    val sb = StringBuilder()

    //joining strings
    sb.append(str1).append(str2).append(str3)

    // StringBuilder to String
    val str4 = sb. toString()

    //displaying final string
    println(str4)
}

Ashaway Crossfire+ Plus String | Tennis Warehouse

Comments: I am an open level player. Prone to serve and volley. Big groundstrokes. I can only say I was dissapointed from the first match with this string. Couldn’t feel more dead with this string. Control is a bit ok just due to the fact that the kevla is terribly dead and doesn’t provide much action or feel or spin at all. After 12 hours of pure hitting, the string makes you work harder for the same spin and power. The cross feels absent. The cheaper Prince strings dont last long but feel much better. Wilson hybrids are better. I tried three Ashaway string sets and got fustrated to the point of cutting and replacing them after two or three sessions.
From:Theo, 10/16

Comments: I had been using the Crossfire IIs on and off years, and when i saw the Crossfire+ come on the market, I picked up a pack. They are nice strings and are fitting of there name as they provide slightly extra pop and spin compared to the Crossfire II’s. I’ll be using the Crossfire Plus’s now for the for the forseeable future, they are fantastic strings for my game. I’m a 4.5 singles player using an Aeropro Lite GT. I’m a smaller guy at 5 5″ and the lighter frame helps me generate more racquet head speed. I get my Aeropro strung at 55 lbs in the crosses and 50 lbs in the mains. The strings lasted me for a month and a half playing 3x a week. The strings are perfect for the racquet as the frame is a little powerful and kevlar strings dampen the power allowing me to take big cuts at the ball generating heavy top spin on my forehand and kick on my serve. If you dont swing very fast you probably aren’t going to like these strings much.
From:Scott, 8/13

Comments: I am a 4.0 player and have used various Wilson brands of strings and have generally been quite happy with them. My experience using this Ashaway Crossfire was the same as the reviewer, Nhan. Good spin and control but nothing that is superior; in fact, playability is way too soft and takes significantly more effort to control the ball and although the feel may be easier on the arm in one respect, it made me work significantly harder to control the ball and the apply power. My impressionwas that the sweet spot was reduced significantly and strings seem to be dead from the get go. I will certainly not be using them anymore.
From:FST, 6/13

Comments: I used these strings in my Wilson BLX Blade Team (54 lbs main, 58 lbscrosses), and at first, I loved them. They provided tons of spin and good pop on mygroundstrokes. My volleys were crisp and accurate. I could feel the strings gripping theball. The main issue I had was with my serve. The strings put more spin on the ball thannormal, even when I was trying to hit flat, so my serve dropped faster and hit the netoften. I had to adjust and aim deeper to get it to go over the net. Once I got used to that,I thought I found my new strings. However, after playing about 4 times, the stringsseemed to go dead (unlike what the other reviewer said). I no longer got the same popon my groundstrokes, and my volleys weren’t as accurate. To make sure it wasn’t justme, I switched to my other racquet (same kind) strung with Wilson Hyperlast Spin at thesame tensions. The pop and accuracy came back. The Wilson doesn’t have quite asmuch spin, but seems to maintain its feel longer. I am a 4.0 doubles player who relies on finesse over power, but I still like to have somepower at my disposal. Four times playing doubles seems like much too short of a time forstrings to lose their feel.
From:Nhan, 6/12

Comments: I use a Babolat AeroPro Drive with these strings. To start off, always string kevlar 10-15% lower than what you would want it at. I strung the kevlar mains at 50 lbs and the synthetic crosses at 55 lbs. These strings with a Babolat gel dampener have given me no arm trouble. They are loaded with power, spin, and bite. Whatever I didn’t totally like about my AeroPro Drive these strings improved upon. These strings are built like a tank. I am a heavy hitter and after over 10 hours of play these strings play exactly the same way they came and believe they will last me another 20 hours. I can’t say enough good things about this string and I am glad to have found the perfect string for me.
From:Wil, 6/12

Stringjoy Signatures | Husky Medium Plus Gauge (11.5-54) Nickel Wound Electric Guitar Strings

Orders placed through Stringjoy.com are eligible for FREE standard domestic shipping on orders over $20 USD (available to all US address including Alaska & Hawaii, US Territories & Military Addresses). Be sure to select the “Free Shipping” option at checkout if your order qualifies. Worldwide shipping is available for a low flat-rate of $6.95. All Stringjoy products are shipped directly from our factory in Nashville, TN, USA.

Typically, it takes up to 2 business days to process your order, regardless of the shipping option selected at checkout. In rare cases we experience extremely high demand and it may take up to 4 business days for your order to ship. We ship Monday through Friday, excluding weekends and holidays. We cannot guarantee Saturday delivery, even if your shipping is upgraded to express. Please allow up to 2 (or in rare cases, 4) business days for orders to process (for example, if you order on Monday, your order should ship out on Tuesday or Wednesday). You will receive a confirmation e-mail with the tracking link once your order ships. Please allow up to 48 hours to receive this shipping confirmation e-mail. Express shipping options and any other third-party fees are non-refundable. We cannot be held accountable for delays caused by the carrier. 

Do note that if inaccurate or incomplete addresses are provided your order may be delayed. Please thoroughly review their shipping information prior to checking out to avoid any such delays.

Territories of the United States: For orders shipped to a territory of the United States, as well as for Hawaii and Alaska, please allow anywhere between 5-15 business days for your order to reach your destination.

P.O. Boxes: We do ship to P.O. Boxes via USPS mail services.

Military Addresses: We do ship to military addresses. We ship these orders via USPS to a military base who is then responsible for delivering the package to your final destination. For military orders, delivery times can range from 15-20 business days.

ESTIMATED DELIVERY TIME

Any estimated delivery window provided by Stringjoy or by the carrier is merely an estimate. No guarantee is made as to the delivery timeframe, and no refunds can be provided on the basis of delivery timeframes.

Domestic Orders: Please allow up to 10 business days before contacting us about the potential your package could be lost.

International Orders: Please allow up to 30 business days before contacting us about the potential your package could be lost.

USA STATE SALES TAXES

Currently, Stringjoy is required to charge and remit sales tax for orders shipped to these states: Arizona, California, Colorado, Connecticut, Georgia, Florida, Illinois, Indiana, Kansas, Maryland, Michigan, Minnesota, Missouri, New Jersey, North Carolina, Ohio, Pennsylvania, South Carolina, Tennessee, Texas, Utah, Virginia, Washington, Wisconsin

These collected taxes are mandated by local and state governments and Stringjoy directly pays the amount we collect to the respective states and municipalities. This list is subject to change without warning.

INTERNATIONAL DUTIES, TAXES & FEES

International customers (outside of the United States) are responsible to pay any applicable inbound duties, taxes, and any other fees which your local Customs authority deems appropriate. These fees are paid to your local carrier or government and are not collected by Stringjoy, and thus cannot be refunded under any circumstances.

We ship international packages DDU (duties and taxes unpaid), meaning that these fees are not included in the price of the goods you purchase from our website. All applicable fees must be paid by the final recipient in order to receive the package. For information on these charges, please contact your country’s customs office or tax agent for respective charges and rates on a package coming outside of your country.

COUNTRIES WE CANNOT SHIP TO

Unfortunately we cannot ship to the following countries (excluding AFO / DPO / FPO Military Mail): Afghanistan, Algeria, Angola, Belarus, Bosnia and Herzegovina, Burundi, Cote d’ivoire (Ivory Coast), Croatia, Cuba, Democratic Republic of the Congo, Iran, Iraq, Jordan, Liberia, Libya, Moldova, Montenegro, Myanmar (Burma), Nigeria, North Korea, Paraguay, Republic of the Congo, Russia, Serbia, Sierra Leone, Somalia, Sri Lanka, Sudan, Syria, Togo, Yemen and Zimbabwe.

Please see our full Shipping Policy for complete details.

What should you expect from Stringjoy Signatures?

1. Present, focused tone that brings out the true voice of your guitar and the details of your playing style.
2. Modern, reconstructed gauges aimed at balancing the tension, tone, and feel of the strings across the fretboard.
3. High-mass winding, leading to higher output, fuller tone, and improved longevity.

How do we make our strings?

• Stringjoy Signatures electric guitar strings are made by a small team in Nashville, TN, USA, out of all-American materials: our top quality Nickel-Plated Steel, wound around a high-carbon hexagonal steel core wire.
• The combination of better materials and more careful craftsmanship creates a more natural-sounding, longer lasting string, without the tone-deadening effects of string coatings.
• We’re known for our quality control. Our strings are wound in small batches, and we use real human beings at every step of the process: the winding, the coiling, the packing, you name it.
• Every string is inspected individually before it goes into your set. If anything is wrong with a string, from the way it’s secured around the ball end, through the entire winding, it doesn’t make the cut.

What does all that mean for you?

✓ Better tuning stability for the life of the string ✓ Longer string life and less breakage, when cared for properly ✓ Smoother, more balanced playability across the neck of the guitar

Questions? Email us!

Storing Strings to String Variables

Storing Strings to String Variables

Storing Strings to String Variables

String Variables

The TI‑84 Plus CE, has 10 variables to which you can store strings. You can use string variables with string functions and instructions.

To display the menu, follow these steps.

Storing a String to a String Variable

To store a string to a string variable, follow these steps.

1.

Press ƒ W, enter the string, and press ƒ W.

The string variable is pasted to the current cursor location, next to the store symbol (!).

5.

Press Í to store the string to the string variable. On the home screen, the stored string is displayed on the next line without quotation marks.

Displaying the Contents of a String Variable

To display the contents of a string variable on the home screen, select the string variable from the menu, and then press Í. The string is displayed.

Handling text — strings in JavaScript – Learn web development

Next, we’ll turn our attention to strings — this is what pieces of text are called in programming. In this article, we’ll look at all the common things that you really ought to know about strings when learning JavaScript, such as creating strings, escaping quotes in strings, and joining strings together.

Words are very important to humans — they are a large part of how we communicate. Since the Web is a largely text-based medium designed to allow humans to communicate and share information, it is useful for us to have control over the words that appear on it. HTML provides structure and meaning to our text, CSS allows us to precisely style it, and JavaScript contains a number of features for manipulating strings, creating custom welcome messages and prompts, showing the right text labels when needed, sorting terms into the desired order, and much more.

Pretty much all of the programs we’ve shown you so far in the course have involved some string manipulation.

Strings are dealt with similarly to numbers at first glance, but when you dig deeper you’ll start to see some notable differences. Let’s start by entering some basic lines into the browser developer console to familiarize ourselves.

Creating a string

1. To start with, enter the following lines:

   let string = 'The revolution will not be televised.';
   string;

   Just like we did with numbers, we are declaring a variable, initializing it with a string value, and then returning the value. The only difference here is that when writing a string, you need to surround the value with quotes.

2. If you don’t do this, or miss one of the quotes, you’ll get an error. Try entering the following lines:

   let badString1 = This is a test;
   let badString2 = 'This is a test;
   let badString3 = This is a test';

   These lines don’t work because any text without quotes around it is assumed to be a variable name, property name, a reserved word, or similar. If the browser can’t find it, then an error is raised (e.g. “missing; before statement”). If the browser can see where a string starts, but can’t find the end of the string, as indicated by the 2nd quote, it complains with an error (with “unterminated string literal”). If your program is raising such errors, then go back and check all your strings to make sure you have no missing quote marks.

3. The following will work if you previously defined the variable string — try it now:

   let badString = string;
   badString;

   badString is now set to have the same value as string.

Single quotes vs. double quotes

1. In JavaScript, you can choose single quotes or double quotes to wrap your strings in. Both of the following will work okay:

   let sgl = 'Single quotes.';
   let dbl = "Double quotes";
   sgl;
   dbl;

2. There is very little difference between the two, and which you use is down to personal preference. You should choose one and stick to it, however; differently quoted code can be confusing, especially if you use two different quotes on the same string! The following will return an error:

   let badQuotes = 'What on earth?";

3. The browser will think the string has not been closed because the other type of quote you are not using to contain your strings can appear in the string. For example, both of these are okay:

   let sglDbl = 'Would you eat a "fish supper"?';
   let dblSgl = "I'm feeling blue.";
   sglDbl;
   dblSgl;

4. However, you can’t include the same quote mark inside the string if it’s being used to contain them. The following will error, as it confuses the browser as to where the string ends:

   let bigmouth = 'I've got no right to take my place...';

   This leads us very nicely into our next subject.

Escaping characters in a string

To fix our previous problem code line, we need to escape the problem quote mark. Escaping characters means that we do something to them to make sure they are recognized as text, not part of the code. In JavaScript, we do this by putting a backslash just before the character. Try this:

let bigmouth = 'I\'ve got no right to take my place...';
bigmouth;

This works fine. You can escape other characters in the same way, e.g. \",  and there are some special codes besides. See Escape sequences for more details.

1. Concatenate is a fancy programming word that means “join together”. Joining together strings in JavaScript uses the plus (+) operator, the same one we use to add numbers together, but in this context it does something different. Let’s try an example in our console.

   let one = 'Hello, ';
   let two = 'how are you?';
   let joined = one + two;
   joined;

   The result of this is a variable called joined, which contains the value “Hello, how are you?”.

2. In the last instance, we joined only two strings, but you can join as many as you like, as long as you include a + between each pair. Try this:

   let multiple = one + one + one + one + two;
   multiple;

3. You can also use a mix of variables and actual strings. Try this:

   let response = one + 'I am fine — ' + two;
   response;

Note: When you enter an actual string in your code, enclosed in single or double quotes, it is called a string literal.

Concatenation in context

Let’s have a look at concatenation being used in action — here’s an example from earlier in the course:

<button>Press me</button>

const button = document.querySelector('button');

button.onclick = function() {
  let name = prompt('What is your name?');
  alert('Hello ' + name + ', nice to see you!');
}

Here we’re using a window.prompt() function in line 4, which asks the user to answer a question via a popup dialog box then stores the text they enter inside a given variable — in this case name. We then use a window.alert() function in line 5 to display another popup containing a string we’ve assembled from two string literals and the name variable, via concatenation.

Numbers vs. strings

1. So what happens when we try to add (or concatenate) a string and a number? Let’s try it in our console:

   You might expect this to return an error,  but it works just fine. Trying to represent a string as a number doesn’t really make sense, but representing a number as a string does, so the browser rather cleverly converts the number to a string and concatenates the two strings.

2. You can even do this with two numbers — you can force a number to become a string by wrapping it in quote marks. Try the following (we are using the typeof operator to check whether the variable is a number or a string):

   let myDate = '19' + '67';
   typeof myDate;

3. If you have a numeric variable that you want to convert to a string but not change otherwise, or a string variable that you want to convert to a number but not change otherwise, you can use the following two constructs:
   • The Number object converts anything passed to it into a number, if it can. Try the following:

     let myString = '123';
     let myNum = Number(myString);
     typeof myNum;

   • Conversely, every number has a method called toString() that converts it to the equivalent string. Try this:

     let myNum2 = 123;
     let myString2 = myNum2.toString();
     typeof myString2;

   These constructs can be really useful in some situations. For example, if a user enters a number into a form’s text field, it’s a string. However, if you want to add this number to something, you’ll need it to be a number, so you could pass it through Number() to handle this. We did exactly this in our Number Guessing Game, in line 54.

Another type of string syntax that you may come across is template literals (sometimes referred to as template strings). This is a newer syntax that provides more flexible, easier to read strings.

Note: Try entering the below examples into your browser’s JavaScript console, to see what results you get.

To turn a standard string literal into a template literal, you have to replace the quote marks (' ', or " ") with backtick characters (` `). So, taking a simple example:

let song = 'Fight the Youth';

Would be turned into a template literal like so:

song = `Fight the Youth`;

If we want to concatenate strings, or include expression results inside them, traditional strings can be fiddly to write:

let score = 9;
let highestScore = 10;
let output = 'I like the song "' + song + '". I gave it a score of ' + (score/highestScore * 100) + '%.';

Template literals simplify this enormously:

output = `I like the song "${ song }". I gave it a score of ${ score/highestScore * 100 }%.`;

There is no more need to open and close multiple string pieces — the whole lot can just be wrapped in a single pair of backticks. When you want to include a variable or expression inside the string, you include it inside a ${ } construct, which is called a placeholder.

You can include complex expressions inside template literals, for example:

let examScore = 45;
let examHighestScore = 70;
examReport = `You scored ${ examScore }/${ examHighestScore } (${ Math.round(examScore/examHighestScore*100) }%). ${ examScore >= 49 ? 'Well done, you passed!' : 'Bad luck, you didn\'t pass this time.' }`;

• The first two placeholders here are pretty simple, only including a simple value in the string.
• The third one calculates a percentage result and rounds it to the nearest integer.
• The fourth one includes a ternary operator to check whether the score is above a certain mark and print a pass or fail message depending on the result.

Another point to note is that if you want to split a traditional string over multiple lines, you need to include a newline character, \n:

output = 'I like the song "' + song + '".\nI gave it a score of ' + (score/highestScore * 100) + '%.';

Template literals respect the line breaks in the source code, so newline characters are no longer needed. This would achieve the same result:

output = `I like the song "${ song }".
I gave it a score of ${ score/highestScore * 100 }%.`;

We would recommend that you get used to using template literals as soon as possible. They are well-supported in modern browsers, and the only place you’ll find a lack of support is Internet Explorer. Many of our examples still use standard string literals, but we will include more template literals going forward.

See our Template literals reference page for more examples and details of advanced features.

You’ve reached the end of this article, but can you remember the most important information? You can find some further tests to verify that you’ve retained this information before you move on — see Test your skills: Strings. Note that this also requires knowledge from the next article, so you might want to read that first.

So that’s the very basics of strings covered in JavaScript. In the next article, we’ll build on this, looking at some of the built-in methods available to strings in JavaScript and how we can use them to manipulate our strings into just the form we want.

Text and Characters
– MATLAB & Simulink

Text in String Arrays

When you are working with text, enclose sequences of characters in double quotes.
You can assign text to a
variable.

If the text includes double quotes, use two double quotes within the
definition.

q = "Something ""quoted"" and something else."

q = 

    "Something "quoted" and something else."

t and q are arrays, like all MATLAB^® variables. Their class or data type is
string.

  Name        Size            Bytes  Class     Attributes
  t           1x1               174  string   

Note

Creating string arrays with double quotes was introduced in R2017a. If you are
using an earlier release, create character arrays. For details, see Data in Character Arrays.

To add text to the end of a string, use the plus operator,
+.

f = 71;
c = (f-32)/1.8;
tempText = "Temperature is " + c + "C"

tempText = 
"Temperature is 21.6667C"

Similar to numeric arrays, string arrays can have multiple elements. Use the
strlength function to find the length of each string within
an
array.

A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]

A = 
  2×3 string array
    "a"       "bb"        "ccc"    
    "dddd"    "eeeeee"    "fffffff"

Data in Character Arrays

Sometimes characters represent data that does not correspond to text, such as a
DNA sequence. You can store this type of data in a character array, which has data
type char. Character arrays use single
quotes.

seq = 'GCTAGAATCC';
whos seq

  Name      Size            Bytes  Class    Attributes
  seq       1x10               20  char               

Each element of the array contains a single
character.

Concatenate character arrays with square brackets, just as you concatenate numeric
arrays.

seq2 = [seq 'ATTAGAAACC']

seq2 =
    'GCTAGAATCCATTAGAAACC'

Character arrays are common in programs that were written before the introduction
of string arrays. All MATLAB functions that accept string data also accept
char data, and vice versa.

String Concatenation and Formatting – PythonForBeginners.com

One common task you’ll need to accomplish with any language involves merging or combining strings. This process is referred to as concatenation.

The best way to describe it is when you take two separate strings – stored by the interpreter – and merge them so that they become one.

For instance, one string would be “hello” and the other would be “world.” When you use concatenation to combine them it becomes one string, or “hello world”.

This post will describe how to concatenate strings in Python. There are different ways to do that, and we will discuss the most common methods. After, we will explore formatting, and how it works.

Concatenation

In Python, there are a few ways to concatenate – or combine – strings. The new string that is created is referred to as a string object. Obviously, this is because everything in Python is an object – which is why Python is an objected-oriented language.

In order to merge two strings into a single object, you may use the “+” operator. When writing code, that would look like this:

str1 = “Hello”
str2 = “World”
str1 + str2

The final line in this code is the concatenation, and when the interpreter executes it a new string will be created.

One thing to note is that Python cannot concatenate a string and integer. These are considered two separate types of objects. So, if you want to merge the two, you will need to convert the integer to a string.

The following example shows what happens when you try to merge a string and integer object. It was copied from David Bau’s personal website.

>>> print ‘red’ + ‘yellow’
Redyellow
>>> print ‘red’ * 3
Redredred
>>> print ‘red’ + 3
Traceback (most recent call last):
File “”, line 1, in
TypeError: cannot concatenate ‘str’ and ‘int’ objects
>>>

For reference, the “>>>” characters indicate where the interpreter is requesting a command.

Notice how multiplying the string “red” three times returns the value “redredred”. This is important, so be sure to record it to memory.

In addition, we can see when trying to combine ‘red’ and 3 the interpreter spits out an error. This is where we are trying to concatenate a string and integer object, and it failed.

In layman’s terms, a string can be any recorded characters but it’s most commonly used to store words and information. An integer on the other hand is a recorded number value that doesn’t have a decimal point. Python cannot add a word and number together. It makes sense why the error happens when you look at it this way.

To make this possible, we can convert the number into a string using the appropriate function. The code for that would look like this:

>>> print ‘red’ + str(3)
red3
>>>

The method we used to do this is the str() function. Notice how the interpreter simply combined the two objects and spit them out when it was asked to print the data?

String Formatting in Python

In Python, we can take advantage of two separate methods of string interpolation.

String interpolation is a term used to describe the process of evaluating a string value that is contained as one or more placeholders. To put it simply, it helps developers with string formatting and concatenation.

Hopefully, you are more familiar with the term yourself because it’s a crucial element of any programming language, especially Python.

String Formatting with the % Operator

Before we take a closer look, it’s important to understand that the % string operator will be deprecated – no longer used – in Python 3.1 and up. Eventually, it will be removed altogether from future versions of the language.

However, it’s still a good idea – and common practice – to become familiar with the method.

The best way to understand how to work with operators is to look at active code.

x = ‘apples’
y = ‘lemons’
z = “In the basket are %s and %s” % (x,y)

What this example code will do is replace the “%s” operator values with the corresponding string, in the order we have set. When you print the “z” string object – after executing the code above – it will return the following:

In the basket are apples and lemons

String Formatting with the { } Operators

When you use the curly braces or {} operators, they serve as place-holders for the variables you would like to store inside a string. In order to pass variables to a string you must call upon the format() method.

One benefit of using the format() method is that you do not have to convert integers into a string before concatenating the data. It will do that automatically for you. This is one reason why it is the preferred operator method.

Again, let’s take a look at some code showing this in action:

Fname = “John”
Lname = “Doe”
Age = “24”


print “{} {} is {} years old.“ format(fname, lname, age)

What this will do is take the appropriate values and store them as variables in the respective string.

Another useful feature of the format() method is that you don’t actually have to feed the inputs to the interpreter in the same order that you want the variables to be displayed, as long as you number the place-holders like so:

print “{0} {1} is {2} years old.” format(fname, lname, age)

Using the Join Method In Python

The join method in Python is used to concatenate a list of strings.

For example

>>> ‘ ‘ .join([‘the’, ‘quick’, ‘brown’, ‘fox’, ‘jumps’, ‘over’, ‘the’, ‘lazy’, ‘dog’])
‘the quick brown fox jumps over the lazy dog’

Let’s create a new list that includes some great bands, but this time let’s do things differently.

>>> music = [“Metallica”, “Rolling Stones”, “ACDC”, “Black Sabbath”, “Shinedown”]

This snippet will create a string – or list – called “music” with the variables we have specified.

You can join the new list by including an empty space, like so:

>>> print ‘ ’.join(music)

You can also join it by starting code on a new line like:

>>> print “
“.join(music)

There is no right or wrong way, use the method you prefer.

Related Posts

Python Strings

Reversing Lists and Strings

String Manipulation

Recommended Python Training

Course: Python 3 For Beginners

Over 15 hours of video content with guided instruction for beginners. Learn how to create real world applications and master the basics.

How to collapse rows under plus

in excel

Structuring (grouping) data on a sheet

See also the same way can be Metalhead Actually, these 4. data and the diagram in the group of text formatting methods) are not displayed, 180 On the tab In the example below, to the right or to the left Total for April 36 456 ₽ Data Setting up a multilevel structure with Note: fix two, three,: Hello! Tell me and the folders are falling out of You can also right-click

totals.To do this Editing and multilevel cells click the Microsoft button 367 Data column E contains from each group 12 636 ₽ Important: in the group styles We try as four, etc. like this in general a plus sign of the group. You need to click in you can perform actions, click the structure button. Apply Office Style 1 126 under Subtotal Rows with Detailed 11

This Article

select B through D,

given in step 36 456 ₽

data summary row.With paragraph

structures with materials on your

lines relevant to

draw buttons ?? I ask the pluses were revealed, and

Insert Structure data.

Create a multilevel structure from lines

1. command structure as well (in Excel 2007). In South Group, column I contains 4, an example is shown Important: On the Group tab Create a summary report from

2. language.This page of Excel 2007 versions forgive me for being feeble, another closed back. Or For more details, see section

   Go after it. other versions open

   • 281 . subtotal data Note: When you select rows, not Data, and then select the chart is automatically translated, therefore 2010. In mind) I really want to Attach an example to

     Delete Create multilevel structure

   • .Select one or more tab 511 Next to the group on for columns with To structure the data by include in the range in the group Make sure that its text can learn to work in earlier versions Which I tried.from strings or

3. Press the button from the following File 410 the screen will display characters F by H, columns data is required for the final row. line

4. contain inaccuracies and (2003 and 2000) Excell… insert the macro itself. To insert a row, select Create a layered structure Select a group of action cells.

5. and select structure 1 202.

   a column J

   1. summary columns with

      tab

   2. select . of each data column, grammatical errors. For tool “Freeze Areas” vikttur Grouped several rows of it, and then from columns.. Automatic final style assignment

   Parameters

   124 If necessary, structure the internal contains a grand total.formulas that refer to Data Group

   1. Manual data structuring

      which requires

      1. us it is important to be in the menu: Bookmark in two pluses.

         on the Hide Details tab by clicking Select Row or Column. Then select the category 750 nested group (separate To group everything into cells in the group> Important: create a structure, there is this article was “Window” on the main Data, Group / Ungroup

         	Made a button that	Main	structure symbols
         only visible cells		Optional	200
         column groups with	initial data for	each of columns	Structure
         Strings	Grouping structure levels	heading that every	is useful to you.Asking for
         page. And there	– play there.	reveals all my	press button
         ,	.	On tab	and section
         1 074	data).	column J select	with details
         select	and then press	manually, map to	column contains data
         give you a couple	must ALWAYS be activated	Microsoft Excel was created	pluses.But how
         Insert	and	Press button	Data
         Show parameters for next	2 276	Internal nested group structuring	columns with B
         of this group.	Group		OK

         screen all data of the same type and seconds and report, cell UNDER fixed

      2. so that close them back, and select to display only OK in the group of sheet Important: (column groups with by I. Indicate the location of the total

         .. To avoid errors

   2. what in the range did she help with the string. Was not convenient

      no spacing enumeration Insert rows into totals sheet as

      1. and then copy Outline select sheet and When selecting columns

         data) A column on the right or Next to group on Next to group on row groupings.There are no empty data for you, using only enter the data of the required rows (of course,. Shown in the following data.

         	press the call button	check the box	do not include in
         For each internal nested	B	to the left of column	the screen will display characters
         characters will appear on the screen	Structure the outer group.	rows or columns.	buttons at the bottom of the page.
         Suppose information in the table	to table, edit	what if	To delete a line, select
         Example of the structure of a string:	Top of page	Dialog Box	Show structure symbols (at
         data range total	groups select columns	C	with details.
         structures.	structures.	External group structuring	Make sure that lines
         For convenience also	has a horizontal direction:	them in accordance with	I will indicate in the same way:
         her and then	For details see p.in	Note:	Structure
         available structure)	the column of this group.	with details,	D
         On tab	Continue highlighting and grouping	Or structure internal nested	Select all subordinate totals
         data also contains	we give a link to		is not concentrated in

         with the specified condition, from 1 to on the tab of the Display section and

      2. On hiding or deleting .. On the tab corresponding to the total column. E Data

         internal lines to group – lines from line and corresponding

      3. row of totals – intermediate original (in English columns, but in but also view 13, the program will compress Main

      4. Hide structured data.Data deletion structures Check the box Press the button Data In the example below F in group as long as

         data for the row with the total defined by it.Execute one language). Lines. For convenience, all rows large in volume

         in all rows in click Create a chart for the total does not occur. Automatic styles OK in group for grouping columns G

         Structure will not create a data section .data. Of the following To group and summarize, the user needs when blocks of information. One)? Insert report In Excel 2007, click .. Structure B to H press the call button all required levels Structuring an internal nested group In the example below, actions.

data in list

Creating a multilevel structure from columns

1. horizontal scrolling fix Column and row names A ideally and select Select the totals that Microsoft Office assigns the style to the existing totals Execute one or more select D for which I

2. Dialog Box Structure.(Groups of rows with row 6 contains the insertion of summary rows when you can create a structure, the first column in can be significantly

   – this is to Delete rows from the sheet need to be presented in, and then – in a row or column from the following Group there is a total column J

3. Structure To ungroup the lines, select with data) the subtotals of the command Help Totals including up to eight which contains the names removed from the cells, when searching for the desired one. Chart View Excel Options

   1. actions.. E, select columns 1 . Them and then For each inner nested for rows with

   2. levels, one line at a time, with which the user of the Excel folder is himself You can also right-click For example, to build a diagram . In other versions, Select the cells to which to show or hide detailed Next to group on B to Region Specify the location of the total column on the

      tab

   3. groups select lines 2nd to 5th, Use command

4. for each group.Select any cell you need works in this

   disclosed plus and

   1. with the mouse button highlighted only by the total

   2. , open the tab, you need to apply the styles. data for the group, the screen will display the characters D. For grouping January On the tab Data with detailed data, Line 10 contains

   Totals

   Each internal level, tables to make Excel moment.And everything showed the desired line of the line and select the data of Baturin and

   1. File

      On the structure tab.

      1. pillars with F February Data in group

         corresponding to the final row.the subtotal data for inserting the function represented by a large number understood with what time to scroll the page, (i.e. without expanding the Belov command, and not and select Data To show details Continue highlighting and grouping by H, for March in group

         	Structure	In the example below	for lines from	INTERMEDIATE.TOTALS directly under	to structure characters,	to work with it.	to see the name,	all folders). But	Insert	based on total results,
         Parameters	in group	groups, press the corresponding	internal columns up to	of which there is a total	Quarter 1	Structure	select command	for grouping lines	7th to 9th,	or above each
         Displays details for	In drop-down menu	is uncomfortable.Therefore, in	is, in my opinion, in general	or	select cells with	. Then select category	Structure	this group button	as long as	column I, select
         April	press the call button	Ungroup	2nd to	a line 11	by group of lines with	of the previous outer level.	tools, select the value	tabular processor available	unreal)	Delete
         A1 to C11,	Optional	press the call button	.	will not be created	columns with F	May	Dialog Box	.	5th, with	contains a grand total.
         for details and	In this case, external	Freeze First Column.	Possibility of fixing areas.	ikki	.	as shown in	and section	Dialog Box	To hide details	all required levels

         H. June Structure Selected structure elements also

      2. has a total row To group all to automatically create the level appears to be less than Now when scrolling horizontally The table usually has : ActiveSheet.Outline.ShowLevels RowLevels: = 1 written by macro recorder

         Highlight one or more examples above Show parameters for next

   2. Group structure, click the corresponding structure.A

      Quarter 2. can be ungrouped without

      1. 6, select the detail lines for the multilevel structure. More by the number in symbols

         leaves to the right with one fixed cap. And in two clicks. Cells. Right-click Create Chart. For example, on a worksheet, in this group, select the button To ungroup the columns B Semester 1 To determine the location of the deletion of the entire structure. From 2 to

         	line 11 select	about using the function	document structure.Use	the column will be stationary.	lines can be	exactly in this	by mouse button and	tab	select the sheet containing	Check the box
         .	required columns, and	C	2	total column left	While holding the SHIFT key,	5th. For grouping	lines from 2nd	“Results” read in	multi-level structure for	To freeze multiple columns,
         from several tens	form.	select command	Box	structure you need	Automatic Styles	Expand or collapse structure	then on tab	D	Eastern	from column
         click the corresponding group	lines from 7th	to 10th.	article INTERMEDIATE.TOTALS function.	quick display totals	it is necessary to select the cell	to several thousand.	ikki	Paste	in group	hide and uncheck
         .	to a certain level	Data	E	371	For detailed data remove	button	on the 9th, at	A	Insert your own totals lines	rows or columns
         at the BOTTOM	Work with multipage	: well, you know better.	.	Diagrams	flag	Press button		in group	F	504

         checkbox or which has a total B

      2. or displaying detailed tables to the RIGHT of with tabular blocks is inconvenient, and yours In the window select Show structure symbols (at

         Apply Styles Among Structure Symbols

5. G 880 Totals in columns on the right and then row 10, highlight C

6. Insert your own summary rows of data for each freeze column.And when the column names are base boxes from here Insert recommended diagrams with structure) .

press the button with press the button H 1 755 from the data on the

tab of the row from the 7th 1 with the formulas directly of the group. You can create a by clicking the “Dock are not visible. All is not visible yet. select row, column or select another

.To format structured data with the required level number Ungroup I 186. To set the location Data for the 9th. Region under or above a multilevel structure from the area. ” Time to scroll to SerArtur or cell for chart type. Select a sheet.can also be applied More details

.

Show and hide structured data

1. J 653

   the location of the total column in group A Month by each group of rows of rows (as shown Task: while scrolling, commit to the beginning, then return: It may be ready.Hides inserts. For example, when creating a chart On the AutoFormats tab . low levels will be Selected structure elements are also 1 229 to the right of the column Structure B Sales with details. in the example below),

2. selected area, which is to the desired cell cells where zeros are

3. Tatiana ivanova using the wizard Data

   Top of page are hidden. can be ungrouped without

Region

Setting up a layered structure with styles

March Sales for Structured Information Row Make the cell active on when scrolling, pin the collection Group in the following example.click, hide the fourth level, click the corresponding March West group from data Important: Month 9 647 ₽ March and April about sales, grouped intersection of fixed rows top row of table RAN

back, respectively, Ungroup When showing or hiding Ungroup

and pressing button button

1. Quarter 1 192 . If during ungrouping Sales 3 use the SUM function, by geographic area

2. and columns. But Excel: : For boxes

these buttons with data in structured and then select

1. ) are not displayed, while

2. or April 185 Press the structure button details 2 East to calculate the intermediate

3. and months, displaying not in itself Create a table and fill in

4. SerArtur green arrows can be list these changes

Point Click Microsoft The Remaining Three Levels

and then

Copy structured data

1. May 143

   OK hidden, lines with East March totals for multiple totals lines of the docked area.It is data.: I did not know how to pull out the menu are displayed and on Delete structure Office will be displayed. on the tab June 520 . detailed data may March 4,101 ₽ sales for these and lines with

2. should be immediately

   We make active any cell to quote so I used – toolbar to make the diagram … and then –

   Show or hide all Data Quarter 2

3. 773 addresses

4. To structure the data, execute also do not display. 9 647 ₽ 4 months. This example is with detailed data. under the required table rows. Go to tag constantly back and forth not

5. Back to top Important: Excel settings

6. structured data in group Half year 1

7. 419 one of the listed To display data 3

East

Hide or delete multilevel structure

is shown in table 1.To display the rows and to the right of the View tab. Tool

Hiding multilevel structure

Deleting a multilevel structure

1. other versions open

2. To display all detailed press the button East 1 557 Automatic data structuring visible line numbers March 7 115 ₽ article structure symbols

   In the drop-down menu of the tool In the drop-down menu, select insert the message text: Tatyana Ivanova The Thinker for optimal placement of the data is hidden, then the data tab, click the Ungroup button 371 2 077 If necessary, select cell next to hidden 4 101 ₽ 5 Specify the location of the total rows: . “Freeze areas” select the function “Anchor top in quotation tags? (9001) 1 minute ago data on the sheet. rows or columns File itself lower level ..

504

Create summary report with chart

4 in range. Lines. On tab 4 East above or below 2. Level 1 contains

1. first option.

   1. line “.

      This is how it looks (link) Note: with details and select

   2. among structure symbols If during ungrouping

      880 North On the Home tab East March

   3. lines with data.total sales by The figure shows that

2. Below the top line appears – message text

   1. Complain Microsoft Excel may not be installed either

      Parameters.For example, if the structures are detailed data 1 755 447 Data in the group March 2 957 ₽

   2. On the tab, all lines with , when scrolling, are marked with delimiting line. Now is gone, there is only Data -> Group the following restrictions on are displayed. For viewing. Then select category

      in structure three are hidden, columns with 186 469 in group

      Cells 7 115 ₽ 6 Data with detailed data.

areas remain at

support.office.com>

How to insert and delete cells, rows and columns

when scrolling vertically, it is not known where the structure is taken from -> the number of lines and

data highlight numbers Extra level, click detailed data can 653 429 Structure click

Inserting and Deleting Column

1. 5 Eastern in the group 3.Level 2 contains locations. sheets table header quote. Group columns: 16384 columns

2. or letters visible and in section. is also not visible. 229 1 345 click the arrow under Format East

   Total for March The structure of the amount of sales by After fixing the line or will always be visible: In the RAN quote back, respectively, Ungroup in width and

Insert and delete row

1. adjacent lines or Show parameters for next To hide all detailed To display data 1 068 579 with item , select item March

2. 23 820 ₽ press the call button every month in the column of the table in Suppose the user needs to fix called the interface these buttons with 1,048 576 rows in columns respectively.At

   worksheets data, click drag pointer through 2 823 180 Group Hide or show 2 957 ₽

Box insert

1. 7 dialog boxes for each region. Menu “Freeze areas” not only a header. gling

2. green arrows can be height. tab select sheet and.

support.office.com>

How to make expanding and collapsing rows in MS Excel. An example in Fig.

visible column numbers 3 367, and then select
, and then click
6 East Structure 4. Level 3 contains the button More One or

becomes available

: In the file from , pull out to the menu To insert a column, select Home
check the box
Top of the page next to hidden Western
1 126
Create structure button Eastern April.Lines with detailed
“Unpin areas.” A couple of lines should Open all pluses

Collapse lines into grouped pluses

– toolbar to it, and then in the group
Show structure symbols (when To represent structured rows in columns. On the tab 192 2 471. Show rows Total for March 4 257 ₽ If the rows of totals are located with data (in this After clicking, all fixed ones will be motionless when pressing the button
constantly back and forth, not on the Cells tab of the presence of a structure) in Microsoft Excel Home 185 5 Structuring data manually.23 820 ₽ 8 above the lines with the case of the line with the area of ​​the worksheet scrolling the worksheet. 3 and close
climb Home press the button. Such styles are used in the group 143 South Important: Back to top of page

7 Oriental data, uncheck
11 through 13). Unlocked.

How to do it: by pressing the button
Exactly, having previously selected press the button Format

Outline Symbols as “Line Level_1” and Cells 520
281 By grouping outline levels manually,

Make sure East

April totals in rows under 5.To display or Note. Unpinning button

Select any cell UNDER 1. The same lines or Insert, select the item “Lines_2 Level”, and to press the button 773 of the address
511 display on the screen

in the first column April 1829 ₽ with data hide the data in the areas »Excel 2003 with a row that will be the most and grouped into columns))))) and select Hide or Display and Presentation of Structured Columns – Format

419 410 all data in
each data line,

4 257 ₽ 9.Otherwise, a layered structure, click and 2000 is found to commit. This will help your file. Why does Nesna Insert columns into sheet and then press

can be used for “Column_1 level” and “Column_2 level”. , select item 365

planetaexcel.ru>

How to freeze row and column in Excel on scroll

1 202 Avoid Errors Requiring 8 East Set only this outline symbol in the Window menu.Excel navigate which additional buttons to make,

: Good afternoon, dear.button for hiding detailed data, In these styles Hide or show 1 557 124 grouping of columns.Create a structure, there is an Oriental

How to freeze a row in Excel when scrolling

April checkbox. And If the tool buttons are exactly the area I do not understand. Forum users. To delete a column, select Show rows not intended for highlighting totals, and then press 2 077

750 Structure the outer group.Headline that every April

1. RUB 6,550 To structure the data, execute
2. . Often used, can be fixed. Or you want every
3. I really need yours, and then or a button

Copy.Rows or Columns Button 4 200

Structuring outgroup (all lines contain data 1 829 ₽ 10 one of the following Create a multilevel structure from

add them to

1. Now select the tool “Pin once to create a new help.”I have Column Mapping tab For details see
2. uses bold, italic column display

Northern 1,074 lines, except for the general one type and 9 Eastern action lines

Quick Access Toolbar. Areas “. Grouping? Has a base of boxes. Home. Section Display and and other formatting back to top 447 2 276 total) what’s in the range

East

How to Freeze a Column in Excel

Total for April Automatically structuring data Create a multilevel structure from To do this, click When horizontal and vertical Nesna is driven into it, click Back to top of the page hiding structured data.

1. text. Changing Methods If Document Outline Characters 469 Important: Select all subordinate totals are missing empty April

$ 90,029 $ 12,636 Select column cell

if necessary

Right-click scrolling remains stationary: Thank you all for a large inventory of 110 boxes.

How to freeze a row and a column at the same time

formatting defined for (429 If selected, do not include

columns and corresponding rows or columns.6 550 ₽ 11 in the range. Display and hide structured and select the proposed header and the top for the answers!

In each box and select Create Summary Report,

On the tab of each of the styles,, 1 345

How to remove a docked area in Excel

total row J them columns with Insert your own total columns 10 East total

Variant data tab.

table row. There are 4 folders that helped a lot.Remove columns from worksheet containing only totals Home can apply various and 579 (grand total). With details. With formulas directly

exceltable.com>

Eastern

MySQL row plus index – Russian Blogs

Reference of articles

When we create a MySQL string index, the most commonly used one is to create an index on all characters. But what we often overlook is that a string can create a left-prefixed index, so a shorter character index can reduce the cost of maintaining the index, as detailed below.

For example, if we receive information about a user through a mailbox, we can execute the following SQL query.

  mysql> select a, b from user where email = '[email protected]';
  

When the above query appears in the code, we often create an index in the email field, and the instruction to create the index usually looks like this:

  mysql> alter table user add index idx_email (email);
  

The above method is our most common practice, so we used the following method?

  mysql> alter table user add index idx_email (email (6));
  

The following diagram is shown for the different ways to create indexes in the above demo:

As you can see from the above illustration, using email (6) can significantly reduce indexing costs.Then let’s analyze the advantages and disadvantages of each of them.

1 、 Back to table : Use the email index to pinpoint the composite condition record ID, then return to the table to get the data, but the email (6) will first get the record ID that can match the conditions and then back to table for evaluation. If the degree of differentiation is low, it can lead to multiple back-to-table operations, which can degrade performance.

2 、 Coverage Index Indexes using email can use private indexes, that is, they can return results without going back to the table. Such as implementation select id, email from user where email = 'xxx' At this time there is no need to go back to the table, for email (6) it is definitely necessary to go back to the table.

To summarize the above, index creation requires consideration Index length , But also index difference should be considered 。

Link: “Geek Time: MySQL Actual Combat”, “High Performance MySQL”
Link: http: // moguhu.com / article / detail? articleId = 121

Own Factory Women Sexy Wholesale Price Three Colors G-String Plus Size Suspenders

ODM & ncy; & acy; & scy; & kcy; & lcy; & acy; & dcy; & iecy; & zhcy; & iecy; & ncy; & shchcy; & icy; & ncy; Sexy & ocy; & pcy; & tcy; & ocy; & vcy; & ycy; & iecy; & tscy; & iecy; & ncy; & ycy; & pcy; & lcy; & yucy; & scy; & rcy; & acy; & zcy; & mcy; & iecy; & rcy; & rcy; & iecy; & mcy; & ncy; & yacy; Garter & bcy; & iecy; & lcy; & ocy; & gcy; & ocy; & tscy; & vcy; & iecy; & tcy; & acy;

& Ncy; & acy; & pcy; & rcy; & ocy; & shcy; & lcy; & ocy; & jcy; & ncy; & iecy; & dcy; & iecy; & lcy; & iecy; & Ucy; & vcy; & acy; & zhcy; & acy; & iecy; & mcy; & ycy; & jcy; & pcy; & rcy; & iecy; & icy; & mcy; & ucy; & shchcy; & iecy; & scy; & tcy; vcy; & acy;

1 & period; & Scy; & pcy; & ocy; & mcy; & ocy; & shchcy; & softcy; & yucy; & scy; & ocy; & bcy; & scy; & tcy; & vcy; & iecy; & ncy; & ncy; & ocy; & gcy; & ocy; & zcy; & acy; & vcy; & ocy; & dcy; & acy; & comma; & vcy; & kcy; & lcy; & yucy; & chcy; & acy; & iecy; & tcy; & vcy; & scy; & iecy; & bcy; & yacy; & vcy; & scy; & iecy; & acy; & scy; & pcy; & iecy; & kcy; & tcy; & ycy; & ocy; & bcy; & scy; & lcy; & ucy; & zhcy; & icy; vcy; & acy; & ncy; & icy; & yacy; & vcy; & tcy; & ocy; & mcy; & chcy; & icy; & scy; & lcy; & iecy; & pcy; & rcy; & ocy; & iecy; & kcy; & tcy; & icy; & rcy; & ocy; & vcy; & acy; & ncy; & icy; & yacy; & comma; & rcy; & acy; & zcy; & rcy; & acy; & bcy; & ocy; & tcy; & kcy; & icy; & comma; & pcy; & rcy; & ocy; & icy; & zcy; & vcy; & ocy; & dcy; & scy; & tcy; & vcy; & acy; & icy; & tcy; & ocy; & rcy; & gcy; & ocy; & vcy; & lcy; & icy; & semi;
2 & period; & iecy; & scy; & tcy; & softcy; & scy; & vcy; & ocy; & icy; & mcy; & ocy; & dcy; & iecy; & lcy; & icy; & period; & mcy; & ocy; & gcy; & ucy; & tcy; & pcy; & rcy; & iecy; & dcy; & lcy; & ocy; & zhcy; & icy; & tcy; & softcy; Ohyeah copyright & icy; & zcy; & ocy; & bcy; & rcy; & acy; & zhcy; & iecy; & ncy; & icy; & jcy; & icy; & vcy; & icy; & dcy; & iecy; & ocy; & comma; & chcy; & tcy; & ocy; & pcy; & ocy; & zcy; vcy; & ocy; & lcy; & yacy; & iecy; & tcy; & icy; & zcy; & bcy; & iecy; & zhcy; & acy; & tcy; & softcy; & ncy; & acy; & rcy; & ucy; & shcy; & iecy; & ncy; & icy; yacy; & semi;
3 & period; & Pcy; & Rcy; & IEcy; & Dcy; & Lcy; & Acy; & Gcy; & Acy; & IEcy; & Tcy; & bcy; & ucy; & mcy; & acy; & gcy; & ucy; & tcy; & iecy; & gcy; & icy; & comma; & scy; & tcy; & icy; & rcy; & acy; & lcy; & softcy; & ncy; & acy; & yacy; & ncy; & acy; & kcy; & lcy; & iecy; & jcy; & kcy; & icy; & comma; & tcy; & kcy; & acy; & ncy; & ocy; & gcy; & ocy; & ncy; & acy; & kcy; & lcy; & iecy; & jcy; & kcy; & icy; & comma; & icy; & chcy; & tcy; & ocy; & bcy; & ycy; & ucy; & pcy; & acy; & kcy; & ocy; & vcy; & kcy; & acy; & scy; & ecy; & mcy; & bcy; & lcy; & iecy; & mcy; & ocy; & jcy; & icy; & scy; & ncy; & icy; & zcy; & kcy; & icy; & mcy; & ucy; & rcy; & ocy; & vcy; & ncy; & iecy; & mcy; MOQ & semi;
4 & period; & Mcy; & ycy; & bcy; & ocy; & lcy; & iecy; & iecy; & chcy; & iecy; & mcy; 700 & comma; 000 & Pcy; & Kcy; & comma; & pcy; & ocy; & mcy; & ocy; & gcy; & iecy; & tcy; & bcy; & ycy; & scy; & tcy; & rcy; & iecy; & iecy; & scy; & ucy; & dcy; & ocy; & khcy; & ocy; & dcy; & scy; & tcy; & vcy; & acy; & semi;
5 & period; & Pcy; & rcy; & iecy; & dcy; & lcy; & acy; & gcy; & acy; & iecy; & tcy; & ocy; & tcy; & lcy; & icy; & chcy; & ncy; & ocy; & iecy; & pcy; & ocy; & scy; & lcy; & iecy; & pcy; & rcy; & ocy; & dcy; & acy; & zhcy; & ncy; & ocy; & iecy; & ocy; & bcy; & scy; & lcy; & ucy; & zhcy; & icy; vcy; & acy; & ncy; & icy; & iecy; & period; & Mcy; & ocy; & zhcy; & ncy; & ocy; & zcy; & acy; & mcy; & iecy; & ncy; & icy; & tcy; & softcy; & ncy; & ocy; & vcy; & ycy; & mcy; & icy; & pcy; & rcy; & icy; & pcy; & ocy; & lcy; & ucy; & chcy; & iecy; & ncy; & icy; & icy; & dcy; & iecy; & fcy; & iecy; & kcy; & tcy; & ncy; & ycy; & khcy; & icy; & zcy; & dcy; & iecy; & lcy; & icy; & jcy; & period;

90,000 Why has the “Heating” line disappeared from the receipts of the Orcs?

Many residents of Orcs noticed that in utility bills for December was missing the line “Heating” .Where did she go? And how to pay for heat now? Let’s tell.

Previously, this line was included in the documents generated by Sistema Gorod JSC. Now – from January 1 – these bills will no longer contain information about charges and payments for heat.

As the Orsk.ru correspondents were told in the Orenburg branch of EnergosbyT Plus, this is due to the termination of the agency agreement with Sistema Gorod JSC.

In short: heating will now be entered on the electricity bill .We will all also receive three documents: the first from EnergosbyT Plus, the second from Sistema Gorod JSC, and the third from Gazprom Mezhregiongaz.

Data of the Orenburg branch “EnergosbyT Plus”

All services of PJSC “T Plus”, charged by the company in Orsk, from January 1, 2021, will be displayed in receipts and in the Personal Account of “EnergosbyT Plus”.

You can still pay for services and transfer meter readings in any usual way: remotely – using free online services on the EnergosbyT Plus oren website.esplus.ru, in your Personal Account or by calling the Contact Center. Tel .: 8 (800) 700-10-32

In person – in the service offices of the company, partner banks, payment agents.

By the way, you can transfer the meter readings around the clock by a separate phone number. To do this, you need to dial (3532) 54-28-25 and, following the instructions of the voice assistant, transfer the data.

Orsk Information Service.ru.

The module for commenting materials from hypercomments.com sites is not part of the Orsk.Ru site, but is a third-party service. The opinion of the editorial board may not coincide with the opinion of the commentators.

parseInt () – JavaScript | MDN

Function parseInt () takes a string as an argument and returns an integer according to the specified radix.

The source for this interactive example is stored in a GitHub repository.If you’d like to contribute to the interactive examples project, please clone https://github.com/mdn/interactive-examples and send us a pull request.

Parameters

string

The value to be interpreted. If the value of parameter string is not a string, it is converted to it (using the abstract operation ToString ). Leading spaces are ignored.

radix

An integer between 2 and 36 that represents the base of the numeric string string described above.Most users use decimal notation and specify 10. Always use this parameter, to avoid reading errors and to ensure correct execution and predictability of the result. When no radix is ​​specified, different implementations may return different results.

Returned value

An integer obtained by parsing (parsing and interpreting) the passed string. If the first character cannot be converted to a number, then NaN is returned.

Function parseInt converts the first argument passed to it to a string type, interprets it, and returns an integer or NaN value . The result (if not NaN ) is an integer and is the first argument ( string ), treated as a number in the specified number system ( radix ). For example, base 10 indicates a conversion from decimal, 8 to octal, 16 to hex, and so on.If the base is greater than 10 , then letters are used to denote numbers greater than 9 . For example, hexadecimal numbers (base 16) use letters A to F .

If function parseInt encounters a character that is not a number in the specified numeral system, it skips this character and all subsequent characters (even if they match) and returns an integer converted from the portion of the string that precedes that character. parseInt strips off the fractional part of the number. Leading and trailing spaces are allowed.

Since some numbers include the character e in their string representation (for example, 6.022e23 ), using parseInt to truncate numeric values ​​can give unexpected results when very small or very large values ​​are used. parseInt should not be used as a replacement for Math.floor () .

If the radix is ​​ undefined (undefined) or 0 (or unspecified), then JavaScript assumes the following by default:

• If the value of the input parameter string begins with " 0x " or " 0X ", is assumed to be base 16, and the rest of the string is interpreted.
• If the value of the input parameter string starts with "0", is taken as the radix either 8 or 10, depending on the specific implementation. ECMAScript 5 specifies the use of 10 (decimal), but not all browsers support this yet, so you must always specify the radix when using function parseInt .
• If the value of the input parameter string begins with any other character, the numeral system is considered decimal (base 10).

If the first character of the string cannot be converted to a number, parseInt returns NaN .

Mathematically, the value NaN is not a number in any number system. To determine if parseInt returns NaN as a result, you can call isNaN . If NaN is involved in arithmetic operations, the result will also be NaN .

To convert a number to a string in the specified number system, use intValue.toString (radix) .

Example: Using

parseInt

All of the following examples return 15 :

  parseInt ("0xF", 16);
parseInt ("F", 16);
parseInt ("17", 8);
parseInt (021, 8);
parseInt ("015", 10);
parseInt (15.99, 10);
parseInt ("FXX123", 16);
parseInt ("1111", 2);
parseInt ("15 * 3", 10);
parseInt ("15e2", 10);
parseInt ("15px", 10);
parseInt ("12", 13);
  

All of the following examples return NaN :

  parseInt ("Hello", 8);
parseInt ("546", 2);
  

All of the following examples return -15 :

  parseInt ("- F", 16);
parseInt ("- 0F", 16);
parseInt ("- 0XF", 16);
parseInt (-15.1, 10)
parseInt ("-17", 8);
parseInt ("-15", 10);
parseInt ("- 1111", 2);
parseInt ("- 15e1", 10);
parseInt ("- 12", 13);
  

All of the following examples return 4 :

  parseInt (4.7, 10);
parseInt (4.7 * 1e22, 10);
parseInt (0.00000000000434, 10);  

The following example returns 224 :

Although not encouraged in the ECMAScript 3 specification and prohibited in ECMAScript 5, many implementations interpret a numeric string starting at 0 as octal.The following example can have both octal and decimal results. To avoid unexpected results, always specify the radix.

  parseInt ("0e0");
parseInt ("08");
  

ECMAScript 5 removes octal interpretation

The ECMAScript 5 specification for the parseInt function no longer allows octal strings that begin with 0 to be interpreted in octal. ECMAScript 5 Declares:

Function parseInt produces an integer value by interpreting the contents of a string argument according to the specified radix.White space at the beginning of the line is ignored. If the radix is ​​not defined or is equal to 0 , it is considered to be equal to 10 , unless the string begins with 0x or 0X : then the radix is ​​16. If the radix is ​​ 16 , the number can also start with the character pairs 0x or 0X .

This is where ECMAScript 5 is at odds with the ECMAScript 3 specification, which discouraged, but did not suppress, octal interpretation.(\ - | \ +)? ([0-9] + | Infinity) $ /. Test (value))
return Number (value);
return NaN;
}

console.log (filterInt ('421'));
console.log (filterInt ('- 421'));
console.log (filterInt ('+ 421'));
console.log (filterInt ('Infinity'));
console.log (filterInt ('421e + 0'));
console.log (filterInt ('421hop'));
console.log (filterInt ('hop1.61803398875'));
console.log (filterInt ('1.61803398875'));


BCD tables only load in the browser

Create rows for current product balances

Function Create a list of lines for document serves to simplify the entry of a large number of lines in expense documents, such as Goods movement, Goods write-off act and the like.All goods in the document are set in one window, that is, to enter a new line, you do not have to open window Current stocks of goods each time.

This function can be connected via a “hotkey” to the expense documents, while you must select the method Create a list of lines for document [CreateListDrugs] .

For details on how to do this, see Entering and Canceling the Payment Date of a Document → Connecting a Hot Key to Document Type .

When the function is connected, it can be called either through the context menu invoked by the right mouse button, More → Create list of strings for document , or using the assigned “hotkey”, for example, F4 .

When the function is called, a window opens Create lines for the current stock of goods :

In order to display the current balances of the goods, in this window it is necessary to press the button Refresh (Refresh the list of the balances of the goods).To narrow down the list of stocks, you can use filters by product groups.

Completion of the document

There are two ways to fill out the document (select the required product and specify the quantity):

1. If the checkbox is not set Reserve goods at consumption :

   • Select the required product, press Enter , set the quantity.
   • Press the button Create document .

   In this case, the product will appear in the document only after pressing the button Create document .

   Note

   When entering the line for entering an expense, the current balance for the selected batch of goods is updated, thus, when several users are working at the same time, each of them, when entering an expense, sees the real balance of the goods for this batch.

2. If checkmark Reserve goods at expense is set, then:

   • Select the required product, press Enter , set the quantity.
   • Press Exit .

   In this case, the product automatically appears in the document (therefore the button Create document is not available).

Additional functions

Using the key F3 you can view information on the receipt for the selected item:

90,000 Unitsky String Technologies completed the construction of an overpass in the UAE

On November 26, the company completed the construction of an innovative transport complex, Sharjah Research, Technology and Innovation Park (SRTIP).

This overpass is part of a larger elevated transport system. Unitsky String Technologies has been designing, building and servicing this system in the MENA region for over a year.

The overground transport solution created by the Belarusian company has a number of key technical and commercial advantages that allow the region to provide the cargo traffic of standard ISO containers up to 5 million tons per year for each overpass at a price of $ 0.01 t km. For passenger transportation, the transport solution provides transportation of a passenger traffic of 50 thousand people per hour on each overpass at a price of $ 0.1 pass · km.

“This is our first project in the United Arab Emirates where our client is the Sharjah Department of Town Planning and Survey. For the UAE, as the technological and innovative Mecca of the Middle East, this is a great opportunity to try our solution in action. And for our company, which already has an operating system in the CIS region, to adapt it to the climatic and landscape features of the MENA region, ”- Nadezhda Kosareva, General Director of Unitsky String Technologies, Inc.

The company’s innovation lies in the design features of track structures and an automatic control system based on artificial intelligence. The complex of engineering solutions of the company allows to reduce the cost of construction and operation of the transport system by more than a third compared to a conventional monorail, two times – with a railway, five times – with a road.

The unique advantages of the transport system developed by Unitsky String Technologies allow the complex use of advanced achievements in the field of electric, high-speed, environmentally friendly transport and transportation.

In addition to the commercial benefits, the MENA region’s multi-level engineering solutions focus on three key industry challenges. First, they allow increasing freight and passenger flows in existing cities without interfering with the existing infrastructure of settlements.Secondly, they allow connecting and optimizing the traffic flow between hard-to-reach mining fields, industrial centers and remote transport hubs (ports, airports, logistics centers) without building additional terminals. And thirdly, the company’s solution provides environmentally friendly transport links with zero pollution and minimal noise levels for regions with high environmental requirements, in which industrial impact on the environment is prohibited or limited.

Unitsky String Technologies, Inc. is an international engineering company dedicated to the design, construction and maintenance of innovative elevated transport solutions.

The head office of the company is located in Minsk (Republic of Belarus).